Skip to main content

pMCh2008_pLenti_Syn_mChe-cdc42E7-E63'UTR
(Plasmid #118622)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118622 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti.Syn(0.5).H2B-eGFP.W
  • Backbone size w/o insert (bp) 7846
  • Total vector size (bp) 10151
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Bleomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    cdc42E7-E6 3'UTR
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1344
  • Mutation
    changed ttgcttt to cggtaag (496 - 502 nt in 3'UTR) for shRNA resistance
  • GenBank ID
    NM_009861 NM_001243769
  • Entrez Gene
    Cdc42
  • Promoter synapsin I (rat)
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCACCACAAGAGGTGCAAGATAG
  • 3′ sequencing primer CAGGGAAGTAGCCTTGTGTGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMCh2008_pLenti_Syn_mChe-cdc42E7-E63'UTR was a gift from Marina Chekulaeva (Addgene plasmid # 118622 ; http://n2t.net/addgene:118622 ; RRID:Addgene_118622)
  • For your References section:

    Alternative 3' UTRs direct localization of functionally diverse protein isoforms in neuronal compartments. Ciolli Mattioli C, Rom A, Franke V, Imami K, Arrey G, Terne M, Woehler A, Akalin A, Ulitsky I, Chekulaeva M. Nucleic Acids Res. 2018 Dec 22. pii: 5258023. doi: 10.1093/nar/gky1270. 10.1093/nar/gky1270 PubMed 30590745