Skip to main content

V5-ERG
(Plasmid #118623)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118623 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    N106
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ERG
  • Species
    H. sapiens (human)
  • GenBank ID
    NP_891548.1
  • Entrez Gene
    ERG (a.k.a. LMPHM14, erg-3, p55)
  • Promoter EF1a
  • Tag / Fusion Protein
    • V5 (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ggcacttgatgtaattctccttg
  • 3′ sequencing primer gtggatgtggaatgtgtgcga
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

V5 tagged TMPRSS2-ERG (aa33-479) with 2aa linker between V5 and ERG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    V5-ERG was a gift from William Hahn (Addgene plasmid # 118623 ; http://n2t.net/addgene:118623 ; RRID:Addgene_118623)
  • For your References section:

    Binding of TMPRSS2-ERG to BAF Chromatin Remodeling Complexes Mediates Prostate Oncogenesis. Sandoval GJ, Pulice JL, Pakula H, Schenone M, Takeda DY, Pop M, Boulay G, Williamson KE, McBride MJ, Pan J, St Pierre R, Hartman E, Garraway LA, Carr SA, Rivera MN, Li Z, Ronco L, Hahn WC, Kadoch C. Mol Cell. 2018 Aug 16;71(4):554-566.e7. doi: 10.1016/j.molcel.2018.06.040. Epub 2018 Aug 2. 10.1016/j.molcel.2018.06.040 PubMed 30078722