Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDONR223-SLC7A11 sh926R
(Plasmid #118701)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 118701 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDNR223
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SLC7A11
  • Species
    H. sapiens (human)
  • Mutation
    wt , SLC7A11 sh926R

Cloning Information

  • Cloning method Gateway Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pDONR223 SLC7A11 insensitive to hairpin TRCN0000288926 (target sequence: CCCTGGAGTTATGCAGCTAAT). Mutated cDNA sequence (GCCCGGCGTGATGCAATTGAT) was confirmed by DNA sequencing,

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDONR223-SLC7A11 sh926R was a gift from William Kaelin (Addgene plasmid # 118701 ; http://n2t.net/addgene:118701 ; RRID:Addgene_118701)
  • For your References section:

    Paracrine Induction of HIF by Glutamate in Breast Cancer: EglN1 Senses Cysteine. Briggs KJ, Koivunen P, Cao S, Backus KM, Olenchock BA, Patel H, Zhang Q, Signoretti S, Gerfen GJ, Richardson AL, Witkiewicz AK, Cravatt BF, Clardy J, Kaelin WG Jr. Cell. 2016 Jun 30;166(1):126-39. doi: 10.1016/j.cell.2016.05.042. 10.1016/j.cell.2016.05.042 PubMed 27368101