-
PurposeLentivirus for expression of shRNA1 against human HIF1a (Dox-inducible)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118704 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1-TetON-Puro
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshRNA against human HIF1a
-
gRNA/shRNA sequenceTGCTCTTTGTGGTTGGATCTA
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (destroyed during cloning)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-TetON-Puro-HIF1a 0819 was a gift from William Kaelin (Addgene plasmid # 118704 ; http://n2t.net/addgene:118704 ; RRID:Addgene_118704) -
For your References section:
Paracrine Induction of HIF by Glutamate in Breast Cancer: EglN1 Senses Cysteine. Briggs KJ, Koivunen P, Cao S, Backus KM, Olenchock BA, Patel H, Zhang Q, Signoretti S, Gerfen GJ, Richardson AL, Witkiewicz AK, Cravatt BF, Clardy J, Kaelin WG Jr. Cell. 2016 Jun 30;166(1):126-39. doi: 10.1016/j.cell.2016.05.042. 10.1016/j.cell.2016.05.042 PubMed 27368101
