-
PurposeBacterial expression plasmid for Inorganic pyrophosphatase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118978 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET21a(+)
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5443
- Total vector size (bp) 6099
-
Modifications to backbonePart of the original backbone, containing the T7 promoter, the RBS and the T7 terminator, was replaced by the insert.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameinorganic diphosphatase IPP1
-
Alt nameInorganic pyrophosphatase
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1376
-
GenBank IDNM_001178359.1
-
Entrez GeneIPP1 (a.k.a. YBR011C, PPA1)
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- 6x-His (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGTCCCATTCGCCAATCCG
- 3′ sequencing primer GCGTCCGGCGTAGAGGATC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe gene was originally cloned to vector pET29b by Yoshihiro Shimizu (RIKEN). (Shimizu, Yoshihiro, et al. "Cell-free translation reconstituted with purified components." Nature biotechnology 19.8 (2001): 751.)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2018/09/18/420570 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-21a(+)-IPP1-His was a gift from Sebastian Maerkl (Addgene plasmid # 118978 ; http://n2t.net/addgene:118978 ; RRID:Addgene_118978) -
For your References section:
A simple, robust, and low-cost method to produce the PURE cell-free system. Lavickova B, Maerkl SJ. ACS Synth Biol. 2019 Jan 11. doi: 10.1021/acssynbio.8b00427. 10.1021/acssynbio.8b00427 PubMed 30632751