Skip to main content

pET-21a(+)-IPP1-His
(Plasmid #118978)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118978 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET21a(+)
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5443
  • Total vector size (bp) 6099
  • Modifications to backbone
    Part of the original backbone, containing the T7 promoter, the RBS and the T7 terminator, was replaced by the insert.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    inorganic diphosphatase IPP1
  • Alt name
    Inorganic pyrophosphatase
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1376
  • GenBank ID
    NM_001178359.1
  • Entrez Gene
    IPP1 (a.k.a. YBR011C, PPA1)
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • 6x-His (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCGTCCCATTCGCCAATCCG
  • 3′ sequencing primer GCGTCCGGCGTAGAGGATC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The gene was originally cloned to vector pET29b by Yoshihiro Shimizu (RIKEN). (Shimizu, Yoshihiro, et al. "Cell-free translation reconstituted with purified components." Nature biotechnology 19.8 (2001): 751.)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/09/18/420570 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-21a(+)-IPP1-His was a gift from Sebastian Maerkl (Addgene plasmid # 118978 ; http://n2t.net/addgene:118978 ; RRID:Addgene_118978)
  • For your References section:

    A simple, robust, and low-cost method to produce the PURE cell-free system. Lavickova B, Maerkl SJ. ACS Synth Biol. 2019 Jan 11. doi: 10.1021/acssynbio.8b00427. 10.1021/acssynbio.8b00427 PubMed 30632751