Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

A3H HapII R175/6E-Cas9n-UGI
(Plasmid #119142)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 119142 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    BE3
  • Backbone manufacturer
    Liu Lab
  • Backbone size w/o insert (bp) 7825
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    APOBEC3H Haplotype II RR175/6EE-Cas9 nickase-UGI
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    549
  • Mutation
    A3H Hap II RR175/6EE
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    A3H HapII R175/6E-Cas9n-UGI was a gift from Reuben Harris (Addgene plasmid # 119142 ; http://n2t.net/addgene:119142 ; RRID:Addgene_119142)
  • For your References section:

    A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes. Martin AS, Salamango DJ, Serebrenik AA, Shaban NM, Brown WL, Harris RS. Sci Rep. 2019 Jan 24;9(1):497. doi: 10.1038/s41598-018-36739-9. 10.1038/s41598-018-36739-9 PubMed 30679582