Skip to main content
Addgene
Open Menu

pColE1_sgRNA_M1S_AmpR
(Plasmid #119153)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119153 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 119153-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 119153-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    YTK095
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the seed region
  • Alt name
    sgRNA-M1S
  • gRNA/shRNA sequence
    GGTAAAATTGTCAACACGCT
  • Promoter J23119

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NsiI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ttatagtcctgtcgggtttcg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Chase Beisel Lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pColE1_sgRNA_M1S_AmpR was a gift from Vincent Noireaux (Addgene plasmid # 119153 ; http://n2t.net/addgene:119153 ; RRID:Addgene_119153)

  • For your References section:

    An educational module to explore CRISPR technologies with a cell-free transcription-translation system. Collias D, Marshall R, Collins SP, Beisel CL, Noireaux V. Synth Biol (Oxf). 2019 Jan 21;4(1):ysz005. doi: 10.1093/synbio/ysz005. eCollection 2019. 10.1093/synbio/ysz005 PubMed 32995532
Related items:
Commonly requested with: