Skip to main content
Addgene

P9_TEVs_cLuc
(Plasmid #119303)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119303 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5443
  • Total vector size (bp) 5882
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    split cLuc connected to P9 coil via TEVs cleavable linker
  • Alt name
    P9_TEVs_cLuc
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P9_TEVs_cLuc was a gift from Roman Jerala (Addgene plasmid # 119303 ; http://n2t.net/addgene:119303 ; RRID:Addgene_119303)
  • For your References section:

    Design of fast proteolysis-based signaling and logic circuits in mammalian cells. Fink T, Lonzaric J, Praznik A, Plaper T, Merljak E, Leben K, Jerala N, Lebar T, Strmsek Z, Lapenta F, Bencina M, Jerala R. Nat Chem Biol. 2019 Feb;15(2):115-122. doi: 10.1038/s41589-018-0181-6. Epub 2018 Dec 10. 10.1038/s41589-018-0181-6 PubMed 30531965