nLuc_AP4_TEVs_P3mS
(Plasmid
#119299)
-
PurposeExpresses N-terminus of split luciferase fused to antiparallel coiled-coil AP4 connected with autoinhibitory coil P3mS and TEV cleavage site in antiparallel harpin linker/for SPOC logic
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119299 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5443
- Total vector size (bp) 7243
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesplit nLuc fused to antiparallel Coiled-coil AP4 connected with P3 via TEV cleavable linker
-
Alt namenLuc_AP4_TEVs_P3mS
-
Insert Size (bp)1800
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
nLuc_AP4_TEVs_P3mS was a gift from Roman Jerala (Addgene plasmid # 119299 ; http://n2t.net/addgene:119299 ; RRID:Addgene_119299) -
For your References section:
Design of fast proteolysis-based signaling and logic circuits in mammalian cells. Fink T, Lonzaric J, Praznik A, Plaper T, Merljak E, Leben K, Jerala N, Lebar T, Strmsek Z, Lapenta F, Bencina M, Jerala R. Nat Chem Biol. 2019 Feb;15(2):115-122. doi: 10.1038/s41589-018-0181-6. Epub 2018 Dec 10. 10.1038/s41589-018-0181-6 PubMed 30531965