Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMSCVpuro-eGFP-hcGAS
(Plasmid #108674)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 108674 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMSCVpuro
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6264
  • Total vector size (bp) 8655
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP-cGAS
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2385
  • Entrez Gene
    CGAS (a.k.a. C6orf150, D4, MB21D1, h-cGAS)
  • Promoter LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCVpuro-eGFP-hcGAS was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 108674 ; http://n2t.net/addgene:108674 ; RRID:Addgene_108674)
  • For your References section:

    cGAS surveillance of micronuclei links genome instability to innate immunity. Mackenzie KJ, Carroll P, Martin CA, Murina O, Fluteau A, Simpson DJ, Olova N, Sutcliffe H, Rainger JK, Leitch A, Osborn RT, Wheeler AP, Nowotny M, Gilbert N, Chandra T, Reijns MAM, Jackson AP. Nature. 2017 Aug 24;548(7668):461-465. doi: 10.1038/nature23449. Epub 2017 Jul 24. 10.1038/nature23449 PubMed 28738408