pAL800
(Plasmid
#119306)
-
Purposeprecusor outer membrane protein A, ompA, with amino acids 1 through 171 deleted and mutations G244C and C290S
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119306 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET503
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)BL21.19
-
Growth instructionslysogen lambda DE3 not required Change media and shift temperature to 39 degrees with IPTG added to produce the precursor proteins
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameprecusor outer membrane protein A, ompA, with amino acids 1 through 171 deleted and mutations G244C and C290S
-
Alt nameOmpA, con, tolG, tut
-
SpeciesEscherichia coli (strain K12)
-
Insert Size (bp)525
-
Mutationamino acids 1 through 171 deleted, and mutatioms Glycine 244 to Cysteine and Cysteine 290 to Serine
-
GenBank ID945571
- Promoter lac
-
Tag
/ Fusion Protein
- none
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer unknown
- 3′ sequencing primer 5' - CACGGCGCTCGGACAGACCC - 3'
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byArnold Driessen at University of Groningen in the Neatherlands
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAL800 was a gift from Linda Randall (Addgene plasmid # 119306 ; http://n2t.net/addgene:119306 ; RRID:Addgene_119306) -
For your References section:
Co-assembly of SecYEG and SecA fully restores the properties of the native translocon. Bariya P, Randall LL. J Bacteriol. 2018 Oct 1. pii: JB.00493-18. doi: 10.1128/JB.00493-18. 10.1128/JB.00493-18 PubMed 30275279