Skip to main content

pC0.055
(Plasmid #119566)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119566 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSB4K5
  • Backbone size w/o insert (bp) 3313
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    PisiAB
  • Insert Size (bp)
    509
  • Mutation
    bp 391 G to A, RBS* added (22 bp) upstream of ATG. See Genbank file for mutations relative to the native promoter.

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer aagattacttcgcgtttgccac
  • 3′ sequencing primer attttttttatctgattaccgcctttgagt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Fe3+ repressed promoter from the isiAB operon. RBS* added (22 bp) upstream of ATG. Please visit https://www.biorxiv.org/content/10.1101/426700v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC0.055 was a gift from Alistair McCormick (Addgene plasmid # 119566 ; http://n2t.net/addgene:119566 ; RRID:Addgene_119566)
  • For your References section:

    CyanoGate: A Modular Cloning Suite for Engineering Cyanobacteria Based on the Plant MoClo Syntax. Vasudevan R, Gale GAR, Schiavon AA, Puzorjov A, Malin J, Gillespie MD, Vavitsas K, Zulkower V, Wang B, Howe CJ, Lea-Smith DJ, McCormick AJ. Plant Physiol. 2019 May;180(1):39-55. doi: 10.1104/pp.18.01401. Epub 2019 Feb 28. 10.1104/pp.18.01401 PubMed 30819783