Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pC0.283
(Plasmid #119649)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 119649 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pICH41276
  • Backbone size w/o insert (bp) 2247
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    7002 NS1 UP Flank
  • Insert Size (bp)
    615

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer ttgagtgagctgataccgct
  • 3′ sequencing primer GTCTCATGAGCGGATACATATTTGAATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Synechoccoccus sp. PCC 7002, downstream sequence for A0932933. Please visit https://www.biorxiv.org/content/10.1101/426700v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC0.283 was a gift from Alistair McCormick (Addgene plasmid # 119649 ; http://n2t.net/addgene:119649 ; RRID:Addgene_119649)
  • For your References section:

    CyanoGate: A Modular Cloning Suite for Engineering Cyanobacteria Based on the Plant MoClo Syntax. Vasudevan R, Gale GAR, Schiavon AA, Puzorjov A, Malin J, Gillespie MD, Vavitsas K, Zulkower V, Wang B, Howe CJ, Lea-Smith DJ, McCormick AJ. Plant Physiol. 2019 May;180(1):39-55. doi: 10.1104/pp.18.01401. Epub 2019 Feb 28. 10.1104/pp.18.01401 PubMed 30819783