Skip to main content
Addgene

FB002
(Plasmid #119676)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119676 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUPD2 (Addgene #68161)
  • Backbone manufacturer
    Diego Orzaez
  • Backbone size w/o insert (bp) 2690
  • Total vector size (bp) 2383
  • Vector type
    Synthetic Biology ; Domestication of DNA parts for GoldenBraid asembly

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Terminator tub
  • Alt name
    Ttub
  • Species
    Neurospora crassa
  • Insert Size (bp)
    274

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmB1 (destroyed during cloning)
  • 3′ cloning site BsmB1 (destroyed during cloning)
  • 5′ sequencing primer GCTTTCGCTAAGGATGATTTCTGG
  • 3′ sequencing primer CAGGGTGGTGACACCTTGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FB002 was a gift from Jose Marcos (Addgene plasmid # 119676 ; http://n2t.net/addgene:119676 ; RRID:Addgene_119676)
  • For your References section:

    FungalBraid: A GoldenBraid-based modular cloning platform for the assembly and exchange of DNA elements tailored to fungal synthetic biology. Hernanz-Koers M, Gandia M, Garrigues S, Manzanares P, Yenush L, Orzaez D, Marcos JF. Fungal Genet Biol. 2018 Jul;116:51-61. doi: 10.1016/j.fgb.2018.04.010. Epub 2018 Apr 20. 10.1016/j.fgb.2018.04.010 PubMed 29680684