Skip to main content

pAL942
(Plasmid #119721)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119721 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET11a
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5677
  • Total vector size (bp) 6535
  • Modifications to backbone
    Induce with IPTG
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    BL21.19
  • Growth instructions
    Change media and shift temperature to 39 degrees with IPTG added to produce the precursor proteins
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    precusor slow-folding ribose import binding protein, rbsB, mutations A248T, A118C and E246C
  • Alt name
    prlB, rbsP
  • Species
    Escherichia coli (strain K12)
  • Insert Size (bp)
    750
  • Mutation
    Alanine 248 to Threonine, Alanine 188 to Cysteine and Glutamate 246 to Cysteine
  • GenBank ID
    948261
  • Promoter T7
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer 5' - CTTGACCGCCAGGCAACG - 3'
  • 3′ sequencing primer 5' - CCAGTTTCAGGATCAACCGG - 3'
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Chankyu Park at Korea Advanced Institute of Science and Technology

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Vector contains T7 promoter, lacI coding sequence, pBR322 origin

Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAL942 was a gift from Linda Randall (Addgene plasmid # 119721 ; http://n2t.net/addgene:119721 ; RRID:Addgene_119721)
  • For your References section:

    Co-assembly of SecYEG and SecA fully restores the properties of the native translocon. Bariya P, Randall LL. J Bacteriol. 2018 Oct 1. pii: JB.00493-18. doi: 10.1128/JB.00493-18. 10.1128/JB.00493-18 PubMed 30275279
Commonly requested with: