Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

SynTagMA_post
(Plasmid #119736)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 119736 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SynTagMA
  • Species
    Synthetic
  • Promoter hSyn-1
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer gtaatccagaggttgattatcg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pCAG_PSD95.FingR-eGFP-CCR5TC was a gift from Don Arnold (Addgene plasmid # 46295) CamPARI2.0 was a kind gift from E.Schreiter Janelia
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SynTagMA_post was a gift from Thomas Oertner (Addgene plasmid # 119736 ; http://n2t.net/addgene:119736 ; RRID:Addgene_119736)
  • For your References section:

    Freeze-frame imaging of synaptic activity using SynTagMA. Alberto Perez-Alvarez, Brenna Fearey, Christian Schulze, Ryan J O'Toole, Benjamien Moeyaert, Manuel Alexander Mohr, Ignacio Arganda-Carreras, Wei Yang, J. Simon Wiegert, Eric R Schreiter, Christine E Gee, Michael B Hoppa, Thomas G Oertner. bioRxiv, Feb 2019 10.1101/538041