-
PurposeSynaptic Tag for Mapping Activity
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119736 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSynTagMA
-
SpeciesSynthetic
- Promoter hSyn-1
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
- 3′ sequencing primer gtaatccagaggttgattatcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypCAG_PSD95.FingR-eGFP-CCR5TC was a gift from Don Arnold (Addgene plasmid # 46295) CamPARI2.0 was a kind gift from E.Schreiter Janelia
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/538041v3 for BioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SynTagMA_post was a gift from Thomas Oertner (Addgene plasmid # 119736 ; http://n2t.net/addgene:119736 ; RRID:Addgene_119736) -
For your References section:
Freeze-frame imaging of synaptic activity using SynTagMA. Perez-Alvarez A, Fearey BC, O'Toole RJ, Yang W, Arganda-Carreras I, Lamothe-Molina PJ, Moeyaert B, Mohr MA, Panzera LC, Schulze C, Schreiter ER, Wiegert JS, Gee CE, Hoppa MB, Oertner TG. Nat Commun. 2020 May 18;11(1):2464. doi: 10.1038/s41467-020-16315-4. 10.1038/s41467-020-16315-4 PubMed 32424147