Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

SynTagMA_pre
(Plasmid #119738)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 119738 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4597
  • Total vector size (bp) 6874
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SynTagMA_pre
  • Species
    Synthetic
  • Insert Size (bp)
    2277
  • Promoter hsyn1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer syn-sense2 GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer S-DIO-R GTTGATTATCGATAAGCTTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Synaptophysin-CamPARI 2 was a kind gift from Mike Hoppa, Dartmouth College
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/538041v3 for BioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SynTagMA_pre was a gift from Thomas Oertner (Addgene plasmid # 119738 ; http://n2t.net/addgene:119738 ; RRID:Addgene_119738)
  • For your References section:

    Freeze-frame imaging of synaptic activity using SynTagMA. Perez-Alvarez A, Fearey BC, O'Toole RJ, Yang W, Arganda-Carreras I, Lamothe-Molina PJ, Moeyaert B, Mohr MA, Panzera LC, Schulze C, Schreiter ER, Wiegert JS, Gee CE, Hoppa MB, Oertner TG. Nat Commun. 2020 May 18;11(1):2464. doi: 10.1038/s41467-020-16315-4. 10.1038/s41467-020-16315-4 PubMed 32424147