Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pMSCVneo-DEST
(Plasmid #119746)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 119746 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMSCVneo
  • Backbone manufacturer
    Clontech
  • Backbone size (bp) 6500
  • Modifications to backbone
    RfB Gateway cassette cloned into pMSCVneo HpaI site
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer pMSCV-5' - CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer pMSCV-3' - GAGACGTGCTACTTCCATTTGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCVneo-DEST was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119746 ; http://n2t.net/addgene:119746 ; RRID:Addgene_119746)
  • For your References section:

    TRAIP promotes DNA damage response during genome replication and is mutated in primordial dwarfism. Harley ME, Murina O, Leitch A, Higgs MR, Bicknell LS, Yigit G, Blackford AN, Zlatanou A, Mackenzie KJ, Reddy K, Halachev M, McGlasson S, Reijns MAM, Fluteau A, Martin CA, Sabbioneda S, Elcioglu NH, Altmuller J, Thiele H, Greenhalgh L, Chessa L, Maghnie M, Salim M, Bober MB, Nurnberg P, Jackson SP, Hurles ME, Wollnik B, Stewart GS, Jackson AP. Nat Genet. 2016 Jan;48(1):36-43. doi: 10.1038/ng.3451. Epub 2015 Nov 23. 10.1038/ng.3451 PubMed 26595769