pMSCVhyg-DEST
(Plasmid
#119747)
-
Purpose(Empty Backbone) Allows Gateway cloning of gene of interest into retroviral pMSCV vector (with Hygromycin resistance)
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 119747 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMSCVhyg
-
Backbone manufacturerClontech
- Backbone size (bp) 7000
-
Modifications to backboneRfB Gateway cassette cloned into pMSCVhyg HpaI site
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer pMSCV-5' - CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer pMSCV-3' - GAGACGTGCTACTTCCATTTGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCVhyg-DEST was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119747 ; http://n2t.net/addgene:119747 ; RRID:Addgene_119747)