Skip to main content
Addgene

pAL950
(Plasmid #119748)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119748 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET11a
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5677
  • Total vector size (bp) 6708
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    BL21.19
  • Growth instructions
    Change media and shift temperature to 39 degrees with IPTG added to produce the precursor proteins
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    precusor Outer membrane pore protein E, phoE, with mutations Alanine 249 to Cysteine and Glutamine 307 to Cysteine
  • Alt name
    ECK0242, JW0231, ompE
  • Species
    Escherichia coli (strain K12)
  • Insert Size (bp)
    1072
  • Mutation
    Internal NdeI site removed and mutations Alanine 249 to Cysteine and Glutamine 307 to Cysteine
  • GenBank ID
    V00316.1
  • Promoter T7
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer 5' - ACTTTGGCGGCAGCGATTTC - 3'
  • 3′ sequencing primer 5' - CCTTTCGGGCTTTGTTAG - 3'
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Hans de Cock at University of Utrecht, The NETHERLANDS

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Vector contains T7 promoter, lacI coding sequence, pBR322 origin

Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAL950 was a gift from Linda Randall (Addgene plasmid # 119748 ; http://n2t.net/addgene:119748 ; RRID:Addgene_119748)
  • For your References section:

    Co-assembly of SecYEG and SecA fully restores the properties of the native translocon. Bariya P, Randall LL. J Bacteriol. 2018 Oct 1. pii: JB.00493-18. doi: 10.1128/JB.00493-18. 10.1128/JB.00493-18 PubMed 30275279