Skip to main content
Addgene

pGEX6P1-DEST-Strep2
(Plasmid #119753)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119753 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEX-6-P1
  • Backbone manufacturer
    Amersham
  • Backbone size (bp) 5000
  • Modifications to backbone
    RfB Gateway cassette cloned into SmaI site to generate pGEX6P1-DEST. Strep-tag II fusion tag cloned into XhoI site of pGEX6P1-DEST, XhoI site only intact on 3' end
  • Vector type
    Bacterial Expression
  • Promoter tac promoter
  • Tags / Fusion Proteins
    • GST (N terminal on insert)
    • Strep-tag II fusion tag (C terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    Ideally grow with Ampicillin and Chloramphenicol in growth medium
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer PGEX5' - GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer PGEX3' - CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX6P1-DEST-Strep2 was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119753 ; http://n2t.net/addgene:119753 ; RRID:Addgene_119753)