Skip to main content

pXPR_sgFLNB-SK2
(Plasmid #119873)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119873 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pXRP_BRD003
  • Backbone manufacturer
    Broad Institute
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgFLNB-SK2
  • gRNA/shRNA sequence
    CCACTGACCAGGCCACAGAT
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001457
  • Entrez Gene
    FLNB (a.k.a. ABP-278, ABP-280, AOI, FH1, FLN-B, FLN1L, LRS1, SCT, TABP, TAP)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_sgFLNB-SK2 was a gift from William Hahn (Addgene plasmid # 119873 ; http://n2t.net/addgene:119873 ; RRID:Addgene_119873)
  • For your References section:

    An alternative splicing switch in FLNB promotes the mesenchymal cell state in human breast cancer. Li J, Choi PS, Chaffer CL, Labella K, Hwang JH, Giacomelli AO, Kim JW, Ilic N, Doench JG, Ly SH, Dai C, Hagel K, Hong AL, Gjoerup O, Goel S, Ge JY, Root DE, Zhao JJ, Brooks AN, Weinberg RA, Hahn WC. Elife. 2018 Jul 30;7. pii: 37184. doi: 10.7554/eLife.37184. 37184 [pii] PubMed 30059005