-
PurposeNme2Cas9 U6-driven sgRNA cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119926 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO_Lenti
- Backbone size w/o insert (bp) 8050
- Total vector size (bp) 8200
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNmeCas9 sgRNA
-
SpeciesN. meningitidis
-
Insert Size (bp)150
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGTGACGTAGAAAGTAATAATTTC
- 3′ sequencing primer CCTCGAGCCGCGGCCAAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Nme2sgRNA_pLKO was a gift from Erik Sontheimer (Addgene plasmid # 119926 ; http://n2t.net/addgene:119926 ; RRID:Addgene_119926) -
For your References section:
A Compact, High-Accuracy Cas9 with a Dinucleotide PAM for In Vivo Genome Editing. Edraki A, Mir A, Ibraheim R, Gainetdinov I, Yoon Y, Song CQ, Cao Y, Gallant J, Xue W, Rivera-Perez JA, Sontheimer EJ. Mol Cell. 2018 Dec 18. pii: S1097-2765(18)31033-5. doi: 10.1016/j.molcel.2018.12.003. 10.1016/j.molcel.2018.12.003 PubMed 30581144