Skip to main content
Addgene

Nme2sgRNA_pLKO
(Plasmid #119926)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119926 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO_Lenti
  • Backbone size w/o insert (bp) 8050
  • Total vector size (bp) 8200
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NmeCas9 sgRNA
  • Species
    N. meningitidis
  • Insert Size (bp)
    150
  • Promoter U6

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGTGACGTAGAAAGTAATAATTTC
  • 3′ sequencing primer CCTCGAGCCGCGGCCAAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Nme2sgRNA_pLKO was a gift from Erik Sontheimer (Addgene plasmid # 119926 ; http://n2t.net/addgene:119926 ; RRID:Addgene_119926)
  • For your References section:

    A Compact, High-Accuracy Cas9 with a Dinucleotide PAM for In Vivo Genome Editing. Edraki A, Mir A, Ibraheim R, Gainetdinov I, Yoon Y, Song CQ, Cao Y, Gallant J, Xue W, Rivera-Perez JA, Sontheimer EJ. Mol Cell. 2018 Dec 18. pii: S1097-2765(18)31033-5. doi: 10.1016/j.molcel.2018.12.003. 10.1016/j.molcel.2018.12.003 PubMed 30581144