Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pMaCTag-Z17
(Plasmid #120060)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 120060 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFA6a
  • Backbone size w/o insert (bp) 2412
  • Vector type
    PCR Template
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mEos4b
  • Species
    H. sapiens (human)
  • Promoter None
  • Tag / Fusion Protein
    • mEos4b (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer SP6
  • 3′ sequencing primer AAACCACAACTAGAATGCAGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Template plasmid for C-terminal PCR tagging of mammalian genes. For M1 and M2 tagging oligo design please visit www.pcr-tagging.com Please visit https://www.biorxiv.org/content/early/2018/11/20/473876 for BioRxiv preprint

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMaCTag-Z17 was a gift from Michael Knop (Addgene plasmid # 120060 ; http://n2t.net/addgene:120060 ; RRID:Addgene_120060)
  • For your References section:

    CRISPR-Cas12a-assisted PCR tagging of mammalian genes. Fueller J, Herbst K, Meurer M, Gubicza K, Kurtulmus B, Knopf JD, Kirrmaier D, Buchmuller BC, Pereira G, Lemberg MK, Knop M. J Cell Biol. 2020 Jun 1;219(6). pii: 151766. doi: 10.1083/jcb.201910210. 10.1083/jcb.201910210 PubMed 32406907