CRISPRi-CENPB-g2
              
              
                (Plasmid
                
                #120210)
              
            
            
            
          - 
            PurposeCENPB CRISPRi guide RNA 2
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120210 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepU6-sgGAL4-1
- 
              Vector typeLentiviral, CRISPR
- 
                Selectable markersPuromycin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature30°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameCENPB CRISPRi guide RNA
- 
                    gRNA/shRNA sequenceGTCGGAGCGCAAGTACGGGG
- 
                    SpeciesH. sapiens (human)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: CRISPRi-CENPB-g2 was a gift from David Bartel (Addgene plasmid # 120210 ; http://n2t.net/addgene:120210 ; RRID:Addgene_120210)
- 
                For your References section: Widespread Influence of 3'-End Structures on Mammalian mRNA Processing and Stability. Wu X, Bartel DP. Cell. 2017 May 18;169(5):905-917.e11. doi: 10.1016/j.cell.2017.04.036. 10.1016/j.cell.2017.04.036 PubMed 28525757
