pCas9CR4-VQR
(Plasmid #120224)

• Purpose: pCas9CR4 with VQR mutations for changing PAM site specificity to NGAN or NGNG from Kleinstiver et al. 2015
• Depositing Lab: Christopher Reisch
• Depositing Organization: University of Florida
  Located in the United States of America
• Publication: pCas9CR4 variants for increased targeting space (unpublished)

Backbone

• Vector backbone: pdCas9-bacteria
• Total vector size (bp): 6770
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: SpCas9-VQR
• Species: Synthetic; E. coli
• Insert Size (bp): 4200
• Mutation: Mutations D1135V/R1335V/T1337R
• Promoter: pTet
• Tag / Fusion Protein:
  • ssrA (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gttgacactctatcgttgat

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene, Stanley Qi

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The TetR protein coding sequence contains an F178S difference compared to the reference sequence that does not impact the function of the plasmid.

DNA (Catalog # 120224-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 120224-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.