pCas9CR5
(Plasmid
#120227)
-
PurposepCas9CR4 with stop codon to prevent translation of ssrA degradation tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120227 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepdCas9-bacteria
- Total vector size (bp) 6765
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSpCas9
-
SpeciesSynthetic; E. coli
-
Insert Size (bp)4200
-
MutationStop codon inserted before ssrA degradation tag
- Promoter pTet
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gttgacactctatcgttgat
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene, Stanley Qi
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCas9CR5 was a gift from Christopher Reisch (Addgene plasmid # 120227 ; http://n2t.net/addgene:120227 ; RRID:Addgene_120227)