Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pET-32a(+)-NRG1B1
(Plasmid #120287)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 120287 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET-32a (+)
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5900
  • Total vector size (bp) 6241
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    BL21 Star/DE3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NRG1-beta 1
  • Alt name
    NRG1B1
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    198
  • Mutation
    Codon optimized for E. Coli production
  • Promoter T7 promoter
  • Tags / Fusion Proteins
    • 6x His (N terminal on insert)
    • S-Tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer taatacgactcactatagg
  • 3′ sequencing primer ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Printed sequence service from SGI

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/685503v2 for BioRxiv preprint

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-32a(+)-NRG1B1 was a gift from Paul Burridge (Addgene plasmid # 120287 ; http://n2t.net/addgene:120287 ; RRID:Addgene_120287)
  • For your References section:

    Negligible-Cost and Weekend-Free Chemically Defined Human iPSC Culture. Kuo HH, Gao X, DeKeyser JM, Fetterman KA, Pinheiro EA, Weddle CJ, Fonoudi H, Orman MV, Romero-Tejeda M, Jouni M, Blancard M, Magdy T, Epting CL, George AL Jr, Burridge PW. Stem Cell Reports. 2020 Jan 9. pii: S2213-6711(19)30446-1. doi: 10.1016/j.stemcr.2019.12.007. 10.1016/j.stemcr.2019.12.007 PubMed 31928950