p3x-Flag Gli3 37R3-2
(Plasmid
#120305)
-
PurposeExpresses human protein Gli containing a 4HT-inducible intein evolved to operate at 37C
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120305 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFLAG-CMV-5.1
-
Backbone manufacturerSigma
- Backbone size w/o insert (bp) 6200
- Total vector size (bp) 9732
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIntein 37R3-2, Gli3
-
SpeciesSynthetic
-
Insert Size (bp)1239
-
MutationContains mutations as reported in 2011 Chemistry and Biology paper
- Promoter CMV
-
Tag
/ Fusion Protein
- 3X Flag
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GGCGGGACTATGGTTGCTGACTAAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p3x-Flag Gli3 37R3-2 was a gift from David Liu (Addgene plasmid # 120305 ; http://n2t.net/addgene:120305 ; RRID:Addgene_120305) -
For your References section:
Directed evolution of a small-molecule-triggered intein with improved splicing properties in mammalian cells. Peck SH, Chen I, Liu DR. Chem Biol. 2011 May 27;18(5):619-30. doi: 10.1016/j.chembiol.2011.02.014. 10.1016/j.chembiol.2011.02.014 PubMed 21609843