-
PurposeExpresses ABE7.10-NLS with an N-terminal His Tag (His6) for bacterial expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120398 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET42b
- Backbone size w/o insert (bp) 5248
- Total vector size (bp) 10570
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameABE7.10
-
Alt nameHis6-TadA-SGGSSGGS-XTEN-SGGSSGGS-TadA*-SGGSSGGS-XTEN-SGGSSGGS-nCas9-SGGS-NLS
-
SpeciesSynthetic
-
Insert Size (bp)5322
-
MutationMammalian codon-optimized
- Promoter T7
-
Tag
/ Fusion Protein
- His (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET42b-ABE7.10 was a gift from Junjiu Huang (Addgene plasmid # 120398 ; http://n2t.net/addgene:120398 ; RRID:Addgene_120398) -
For your References section:
Genome-wide profiling of adenine base editor specificity by EndoV-seq. Liang P, Xie X, Zhi S, Sun H, Zhang X, Chen Y, Chen Y, Xiong Y, Ma W, Liu D, Huang J, Songyang Z. Nat Commun. 2019 Jan 8;10(1):67. doi: 10.1038/s41467-018-07988-z. 10.1038/s41467-018-07988-z PubMed 30622278