pORTMAGE311B
(Plasmid #120418)

• Purpose: Expresses Lambda Beta and a dominant negative MutL E32K allele, controlled by XylS-Pm expression system for high precision and efficient MAGE experiments at 37°C. RSF1010 Ori; Broad host-range; KanR
• Depositing Lab: Csaba Pál
• Publication: Szili et al bioRxiv (2018)

Backbone

• Vector backbone: pSEVA258
• Backbone manufacturer: The Standard European Vector Architecture (SEVA); http://seva.cnb.csic.es/
• Total vector size (bp): 9880
• Vector type: Bacterial Expression
• Selectable markers: Kanamycin, Kan

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): E. coli K-12 MG1655
• Growth instructions: Induction of expression of Lambda recombinases and MutL E32K allele at 37°C for 15-30 minutes by the addition of 1mM m-toluic-acid
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: MutL E32K
• Alt name: dominant, negative MutL allele
• Species: Synthetic; Escherichia coli K-12
• Insert Size (bp): 1848
• Mutation: E32K mutation conferring dominant mutator phenotype
• Promoter: Pm

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: - (unknown if destroyed)
• 3′ cloning site: - (unknown if destroyed)
• 5′ sequencing primer: CTAGGGCGGCGGATTTGTCC
• 3′ sequencing primer: GCGGCAACCGAGCGTTCTG

Gene/Insert 2

• Gene/Insert name: Lambda Beta
• Alt name: Bet
• Species: Synthetic; E. coli Lambda phage
• Insert Size (bp): 786
• Promoter: Pm

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: None (unknown if destroyed)
• 3′ cloning site: None (unknown if destroyed)
• 5′ sequencing primer: CTAGGGCGGCGGATTTGTCC
• 3′ sequencing primer: GCGGCAACCGAGCGTTCTG

Gene/Insert 3

• Gene/Insert name: XylS
• Alt name: Transcriptional regulator XylS
• Species: Pseudomonas sp.
• Insert Size (bp): 966

Resource Information

• Supplemental Documents:
  • pORTMAGE 311B.gb
• A portion of this plasmid was derived from a plasmid made by: based on pSEVA258beta, from Ricaurte, Deirdre E., Esteban Martínez‐García, Ákos Nyerges, Csaba Pál, Víctor de Lorenzo, and Tomás Aparicio. “A Standardized Workflow for Surveying Recombinases Expands Bacterial Genome-Editing Capabilities.” Microbial Biotechnology 11, no. 1 (January 1, 2018): 176–88. https://doi.org/10.1111/1751-7915.12846
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit the depositor's website: http://group.szbk.u-szeged.hu/sysbiol/pal-csaba-lab-resources.html for additional information.

To view a protocol for using this plasmid, please visit http://group.szbk.u-szeged.hu/sysbiol/EvGEn/resources.html

Please visit https://www.biorxiv.org/content/10.1101/495630v1 for bioRxiv preprint.