-
PurposeExpresses Lambda Beta and a dominant negative MutL E32K allele, controlled by XylS-Pm expression system for high precision and efficient MAGE experiments at 37°C. RSF1010 Ori; Broad host-range; KanR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120418 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSEVA258
-
Backbone manufacturerThe Standard European Vector Architecture (SEVA); http://seva.cnb.csic.es/
- Total vector size (bp) 9880
-
Vector typeBacterial Expression
-
Selectable markersKanamycin, Kan
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)E. coli K-12 MG1655
-
Growth instructionsInduction of expression of Lambda recombinases and MutL E32K allele at 37°C for 15-30 minutes by the addition of 1mM m-toluic-acid
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMutL E32K
-
Alt namedominant, negative MutL allele
-
SpeciesSynthetic; Escherichia coli K-12
-
Insert Size (bp)1848
-
MutationE32K mutation conferring dominant mutator phenotype
- Promoter Pm
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site - (unknown if destroyed)
- 3′ cloning site - (unknown if destroyed)
- 5′ sequencing primer CTAGGGCGGCGGATTTGTCC
- 3′ sequencing primer GCGGCAACCGAGCGTTCTG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameLambda Beta
-
Alt nameBet
-
SpeciesSynthetic; E. coli Lambda phage
-
Insert Size (bp)786
- Promoter Pm
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site None (unknown if destroyed)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer CTAGGGCGGCGGATTTGTCC
- 3′ sequencing primer GCGGCAACCGAGCGTTCTG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameXylS
-
Alt nameTranscriptional regulator XylS
-
SpeciesPseudomonas sp.
-
Insert Size (bp)966
Resource Information
-
A portion of this plasmid was derived from a plasmid made bybased on pSEVA258beta, from Ricaurte, Deirdre E., Esteban Martínez‐García, Ákos Nyerges, Csaba Pál, Víctor de Lorenzo, and Tomás Aparicio. “A Standardized Workflow for Surveying Recombinases Expands Bacterial Genome-Editing Capabilities.” Microbial Biotechnology 11, no. 1 (January 1, 2018): 176–88. https://doi.org/10.1111/1751-7915.12846
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit the depositor's website: http://group.szbk.u-szeged.hu/sysbiol/pal-csaba-lab-resources.html for additional information.
To view a protocol for using this plasmid, please visit http://group.szbk.u-szeged.hu/sysbiol/EvGEn/resources.html
Please visit https://www.biorxiv.org/content/10.1101/495630v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pORTMAGE311B was a gift from Csaba Pál (Addgene plasmid # 120418 ; http://n2t.net/addgene:120418 ; RRID:Addgene_120418) -
For your References section:
Rapid Evolution of Reduced Susceptibility against a Balanced Dual-Targeting Antibiotic through Stepping-Stone Mutations. Szili P, Draskovits G, Revesz T, Bogar F, Balogh D, Martinek T, Daruka L, Spohn R, Vasarhelyi BM, Czikkely M, Kintses B, Grezal G, Ferenc G, Pal C, Nyerges A. Antimicrob Agents Chemother. 2019 Aug 23;63(9). pii: AAC.00207-19. doi: 10.1128/AAC.00207-19. Print 2019 Sep. 10.1128/AAC.00207-19 PubMed 31235632