Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pORTMAGE-2
(Plasmid #72677)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 72677 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSIM8
  • Backbone manufacturer
    Datta S. et al. (Gene 379 (2006) 109-115)
  • Backbone size w/o insert (bp) 6248
  • Total vector size (bp) 8096
  • Modifications to backbone
    MutL E32K allele cloned into vector
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Induction of expression of Lambda recombinases and MutL E32K allele at 42°C for 15 minutes, otherwise grow at 30°C
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mutL E32K
  • Species
    Escherichia coli
  • Insert Size (bp)
    1848
  • Mutation
    E32K mutation conferring dominant mutator phenotype
  • Promoter pL promoter
  • Tag / Fusion Protein
    • none (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAATGCCTGGTACTTTGCCAA
  • 3′ sequencing primer ATAACAGAAAGGCCGGGAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit the depositor's website: http://group.szbk.u-szeged.hu/sysbiol/pal-csaba-lab-resources.html for additional resource information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pORTMAGE-2 was a gift from Csaba Pál (Addgene plasmid # 72677 ; http://n2t.net/addgene:72677 ; RRID:Addgene_72677)
  • For your References section:

    A highly precise and portable genome engineering method allows comparison of mutational effects across bacterial species. Nyerges A, Csorgo B, Nagy I, Balint B, Bihari P, Lazar V, Apjok G, Umenhoffer K, Bogos B, Posfai G, Pal C. Proc Natl Acad Sci U S A. 2016 Feb 16. pii: 201520040. 10.1073/pnas.1520040113 PubMed 26884157