pCRIS
(Plasmid
#120424)
-
PurposeThis plasmid encodes the complete CRISPR/dCas9 machinery for repressing transposition of the following bacterial Insertion Sequences: IS1, IS3, IS5, and IS150.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120424 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCRISPathBrick
- Backbone size w/o insert (bp) 9326
- Total vector size (bp) 9590
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRISPR spacers targeting IS1, IS5, IS3, IS150
-
gRNA/shRNA sequenceATGCTGCCAACTTACTGATTTAGTGTATGAgttttagagctatgctgttttgaatggtcccaaaacGGCTCCAGATGACA AACATGATCTCATATCgttttagagctatgctgttttgaatggtcccaaaacACGCGGCTAAGTGAGTAAACTCTCAGTC AGgttttagagctatgctgttttgaatggtcccaaaacGGGGCTATTCCATTTCATCGTCCAACAAAAgttttagagcta tgctgttttgaatggtcccaaaac
-
SpeciesEscherichia coli
- Promoter constitutive
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer n/a (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2018/09/27/428029 for BioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRIS was a gift from Tamás Fehér (Addgene plasmid # 120424 ; http://n2t.net/addgene:120424 ; RRID:Addgene_120424) -
For your References section:
CRISPR-interference-based modulation of mobile genetic elements in bacteria. Nyerges A, Balint B, Cseklye J, Nagy I, Pal C, Feher T. Synth Biol (Oxf). 2019;4(1):ysz008. doi: 10.1093/synbio/ysz008. Epub 2019 Mar 15. 10.1093/synbio/ysz008 PubMed 31008359