Skip to main content

pCRIS
(Plasmid #120424)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120424 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCRISPathBrick
  • Backbone size w/o insert (bp) 9326
  • Total vector size (bp) 9590
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CRISPR spacers targeting IS1, IS5, IS3, IS150
  • gRNA/shRNA sequence
    ATGCTGCCAACTTACTGATTTAGTGTATGAgttttagagctatgctgttttgaatggtcccaaaacGGCTCCAGATGACA AACATGATCTCATATCgttttagagctatgctgttttgaatggtcccaaaacACGCGGCTAAGTGAGTAAACTCTCAGTC AGgttttagagctatgctgttttgaatggtcccaaaacGGGGCTATTCCATTTCATCGTCCAACAAAAgttttagagcta tgctgttttgaatggtcccaaaac
  • Species
    Escherichia coli
  • Promoter constitutive

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/09/27/428029 for BioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRIS was a gift from Tamás Fehér (Addgene plasmid # 120424 ; http://n2t.net/addgene:120424 ; RRID:Addgene_120424)
  • For your References section:

    CRISPR-interference-based modulation of mobile genetic elements in bacteria. Nyerges A, Balint B, Cseklye J, Nagy I, Pal C, Feher T. Synth Biol (Oxf). 2019;4(1):ysz008. doi: 10.1093/synbio/ysz008. Epub 2019 Mar 15. 10.1093/synbio/ysz008 PubMed 31008359