Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pLEX-FKBP-Rab7a-Blasticidin
(Plasmid #120716)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 120716 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLEX
  • Backbone manufacturer
    Thermo Scientific
  • Backbone size w/o insert (bp) 11000
  • Total vector size (bp) 12000
  • Modifications to backbone
    Puromycin resistance cassette swapped for blasticidin resistance.
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Rab7a
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1728
  • Promoter CMV
  • Tags / Fusion Proteins
    • FKBP (N terminal on insert)
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CACCAAAATCAACGGGACTT
  • 3′ sequencing primer ATATAGACAAACGCACACCGGCCT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    FKBP-mCherry-Rab7a insert was cloned out of Addgene plasmid #72903.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLEX-FKBP-Rab7a-Blasticidin was a gift from Paul Khavari (Addgene plasmid # 120716 ; http://n2t.net/addgene:120716 ; RRID:Addgene_120716)
  • For your References section:

    The Functional Proximal Proteome of Oncogenic Ras Includes mTORC2. Kovalski JR, Bhaduri A, Zehnder AM, Neela PH, Che Y, Wozniak GG, Khavari PA. Mol Cell. 2019 Jan 4. pii: S1097-2765(18)31031-1. doi: 10.1016/j.molcel.2018.12.001. 10.1016/j.molcel.2018.12.001 PubMed 30639242