PB-Antares2
(Plasmid
#120868)
-
PurposePiggybac transposon plasmid for live animal optical imaging
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120868 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePB-CAG-eGFPd2
-
Backbone manufacturerSynBio-Tech
- Backbone size w/o insert (bp) 5290
- Total vector size (bp) 7200
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepcDNA3-Antares2
-
SpeciesSynthetic
-
Insert Size (bp)1910
-
MutationAntares2 amplicon
- Promoter CAG Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bsr-GI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GAATTCCACTATAGGGAGACCCAAGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-Antares2 was a gift from Jordan Green (Addgene plasmid # 120868 ; http://n2t.net/addgene:120868 ; RRID:Addgene_120868) -
For your References section:
Photocrosslinked Bioreducible Polymeric Nanoparticles for Enhanced Systemic siRNA Delivery as Cancer Therapy. Karlsson J, Tzeng SY, Hemmati S, Luly KM, Choi O, Rui Y, Wilson DR, Kozielski KL, Quinones-Hinojosa A, Green JJ. Adv Funct Mater. 2021 Apr 22;31(17). doi: 10.1002/adfm.202009768. Epub 2021 Feb 22. 10.1002/adfm.202009768 PubMed 34650390