pACYC-Cas12c2-noncoding
(Plasmid
#120877)
-
PurposeExpresses concatenated noncoding sequences surrounding the CRISPR-Cas12c2 system in the native genomic loci; expresses the tracrRNA required for activity.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120877 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACYC184
-
Backbone manufacturerATCC
- Backbone size w/o insert (bp) 4327
- Total vector size (bp) 5978
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNoncoding sequences for CRISPR-Cas12c2
-
SpeciesSynthetic
-
Insert Size (bp)1651
- Promoter lac
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at [email protected].
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACYC-Cas12c2-noncoding was a gift from Arbor Biotechnologies (Addgene plasmid # 120877 ; http://n2t.net/addgene:120877 ; RRID:Addgene_120877) -
For your References section:
Functionally diverse type V CRISPR-Cas systems. Yan WX, Hunnewell P, Alfonse LE, Carte JM, Keston-Smith E, Sothiselvam S, Garrity AJ, Chong S, Makarova KS, Koonin EV, Cheng DR, Scott DA. Science. 2019 Jan 4;363(6422):88-91. doi: 10.1126/science.aav7271. Epub 2018 Dec 6. 10.1126/science.aav7271 PubMed 30523077