-
Purposeencodes a GAG-dCAS9-VPR fusion for targeted transcriptional activation.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120922 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3-like
- Total vector size (bp) 12436
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGAG (FMLV)-dCAS9-VPR
-
SpeciesH. sapiens (human)
- Promoter hCMV
-
Tag
/ Fusion Protein
- none (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho I not unique (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer ACTACATCCTGGTCATCATCC
- 3′ sequencing primer CCACCTTCTGATAGGCAGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bycloned from plasmid addgene #63798 SP-dCAS9-VPR
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2017/10/12/202010 for BioRxiv preprint. Please note the S1159N point mutation found in Cas9 is not of functional concern.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BICstim-Gag-dCAS9-VPR was a gift from Philippe Mangeot & Théophile Ohlmann & Emiliano Ricci (Addgene plasmid # 120922 ; http://n2t.net/addgene:120922 ; RRID:Addgene_120922) -
For your References section:
Genome editing in primary cells and in vivo using viral-derived Nanoblades loaded with Cas9-sgRNA ribonucleoproteins. Mangeot PE, Risson V, Fusil F, Marnef A, Laurent E, Blin J, Mournetas V, Massourides E, Sohier TJM, Corbin A, Aube F, Teixeira M, Pinset C, Schaeffer L, Legube G, Cosset FL, Verhoeyen E, Ohlmann T, Ricci EP. Nat Commun. 2019 Jan 3;10(1):45. doi: 10.1038/s41467-018-07845-z. 10.1038/s41467-018-07845-z PubMed 30604748