Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO-Tet-On-shRab27a
(Plasmid #120930)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 120930 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRab27a
  • gRNA/shRNA sequence
    GCTTCTGTTCGACCTGACAAA
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_001301230.1
  • Entrez Gene
    Rab27a (a.k.a. 2210402C08Rik, 2410003M20Rik, 4933437C11Rik, ash)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-Tet-On-shRab27a was a gift from Mien-Chie Hung (Addgene plasmid # 120930 ; http://n2t.net/addgene:120930 ; RRID:Addgene_120930)
  • For your References section:

    Exosomal PD-L1 harbors active defense function to suppress T cell killing of breast cancer cells and promote tumor growth. Yang Y, Li CW, Chan LC, Wei Y, Hsu JM, Xia W, Cha JH, Hou J, Hsu JL, Sun L, Hung MC. Cell Res. 2018 Aug;28(8):862-864. doi: 10.1038/s41422-018-0060-4. Epub 2018 Jun 29. 10.1038/s41422-018-0060-4 PubMed 29959401