Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO-Tet-On-shRNA-Control
(Plasmid #98398)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 98398 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Tet-pLKO-Puro (pLKO-Tet-On) Addgene #21915
  • Backbone manufacturer
    Dmitri Wiederschain
  • Backbone size w/o insert (bp) 8758
  • Total vector size (bp) 8816
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    non-targeting randomized sequence
  • gRNA/shRNA sequence
    ATCTCGCTTGGGCGAGAGTAAG
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer SHSEQ2 GGAAATCACCATAAACGTGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-Tet-On-shRNA-Control was a gift from Roland Friedel (Addgene plasmid # 98398 ; http://n2t.net/addgene:98398 ; RRID:Addgene_98398)
  • For your References section:

    Plexin-B2 orchestrates collective stem cell dynamics via actomyosin contractility, cytoskeletal tension and adhesion. Junqueira Alves C, Dariolli R, Haydak J, Kang S, Hannah T, Wiener RJ, DeFronzo S, Tejero R, Gusella GL, Ramakrishnan A, Alves Dias R, Wojcinski A, Kesari S, Shen L, Sobie EA, Rodrigues Furtado de Mendonca JP, Azeloglu EU, Zou H, Friedel RH. Nat Commun. 2021 Oct 14;12(1):6019. doi: 10.1038/s41467-021-26296-7. 10.1038/s41467-021-26296-7 PubMed 34650052