P9m
              
              
                (Plasmid
                
                #120937)
              
            
            
            
          - 
            PurposeMoClo golden gate assembly AB part for pOR1-OR2 (lambda cI-repressable strong promoter) - Please see Supplemental Documents for annotated Genbank file
- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120937 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backboneDVA
- Backbone size w/o insert (bp) 2100
- 
              Vector typeSynthetic Biology
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature30°C
- 
            Growth Strain(s)KL740
- 
              Growth instructionsTo avoid mutations, grow this plasmid in KL740 E. coli, or another strain containing lambda cI. If in KL740, grow at 30degreesC.
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert namePr-OR1-OR2
- 
                    SpeciesSynthetic
- 
                  Insert Size (bp)85
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AAATAGGCGTATCACGAGGCA
- 3′ sequencing primer TTACCGCCTTTGAGTGAGCTG (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Very strong promoter! To avoid mutations, grow this plasmid in KL740 E. coli, or another strain containing lambda cI. If in KL740, grow at 30degreesC.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: P9m was a gift from Richard Murray (Addgene plasmid # 120937 ; http://n2t.net/addgene:120937 ; RRID:Addgene_120937)
 
    
 
    
