T1m
(Plasmid
#121028)
-
PurposeMoClo golden gate assembly DE part for T500 terminator Engineered terminator derived from bacteriophage 83; see DOI: 10.1126/science.284.5414.611).
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 121028 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneDVA
- Backbone size w/o insert (bp) 2100
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT500_noGap, short attachment (T11)
-
SpeciesSynthetic
-
Insert Size (bp)49
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AAATAGGCGTATCACGAGGCA
- 3′ sequencing primer TTACCGCCTTTGAGTGAGCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see Supplemental Documents for annotated Genbank file.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T1m was a gift from Richard Murray (Addgene plasmid # 121028 ; http://n2t.net/addgene:121028 ; RRID:Addgene_121028)