Skip to main content

pLenti-TagGFP2
(Plasmid #121426)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121426 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti-Origene
  • Total vector size (bp) 6970
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    empty TagGFP2
  • Promoter CMV
  • Tag / Fusion Protein
    • TagGFP2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TGCAGGGGAAAGAATAGTAGAC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Antonia A. Dominguez and Lei S. Qi, Stanford University

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-TagGFP2 was a gift from Ovijit Chaudhuri & Stanley Qi (Addgene plasmid # 121426 ; http://n2t.net/addgene:121426 ; RRID:Addgene_121426)
  • For your References section:

    YAP-independent mechanotransduction drives breast cancer progression. Lee JY, Chang JK, Dominguez AA, Lee HP, Nam S, Chang J, Varma S, Qi LS, West RB, Chaudhuri O. Nat Commun. 2019 Apr 23;10(1):1848. doi: 10.1038/s41467-019-09755-0. 10.1038/s41467-019-09755-0 PubMed 31015465