Skip to main content
Addgene

HA-Foxo1ADA (pCMV5)
(Plasmid #12143)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 12143 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV5
  • Backbone size w/o insert (bp) 4657
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Foxo1 ADA
  • Alt name
    Fkhr ADA
  • Alt name
    Foxo1
  • Alt name
    forkhead box O1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2100
  • Mutation
    Phosphorylation-deficient, also referred to as constitutivley active. Contians three point mutaitons: Thr24Ala, Ser253Asp, Ser316Ala*
  • Entrez Gene
    Foxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
  • Promoter CMV
  • Tags / Fusion Proteins
    • myc (N terminal on backbone)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer hGH-pA-R (CCAGCTTGGTTCCCAATAGA)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Also contains G282R, K219R, and L619P polymorphisms, which are not known to affect function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HA-Foxo1ADA (pCMV5) was a gift from Domenico Accili (Addgene plasmid # 12143 ; http://n2t.net/addgene:12143 ; RRID:Addgene_12143)
  • For your References section:

    The forkhead transcription factor Foxo1 (Fkhr) confers insulin sensitivity onto glucose-6-phosphatase expression. Nakae J, Kitamura T, Silver DL, Accili D. J Clin Invest. 2001 Nov . 108(9):1359-67. 10.1172/JCI12876 PubMed 11696581