-
PurposeExpresses codon-optimized SpCas9 in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 121507 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpCas9
-
SpeciesSynthetic
-
Insert Size (bp)4197
- Promoter U1a
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCGATGCTGTACTTCTTGTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe SpCas9 sequence is from PX551 (Addgene, Plasmid #60957)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV.pU1a-SpCas9 was a gift from Guangping Gao (Addgene plasmid # 121507 ; http://n2t.net/addgene:121507 ; RRID:Addgene_121507) -
For your References section:
Cas9-mediated allelic exchange repairs compound heterozygous recessive mutations in mice. Wang D, Li J, Song CQ, Tran K, Mou H, Wu PH, Tai PWL, Mendonca CA, Ren L, Wang BY, Su Q, Gessler DJ, Zamore PD, Xue W, Gao G. Nat Biotechnol. 2018 Oct;36(9):839-842. doi: 10.1038/nbt.4219. Epub 2018 Aug 13. 10.1038/nbt.4219 PubMed 30102296