peAAV-CKII(0.4)-Chronos_eGFP_GP2A_nls_mScarlet
(Plasmid
#121542)
-
PurposeChronos with red nucleus-targeted fluorescence for excitatory neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 121542 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Total vector size (bp) 7844
-
Vector typeAAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameblue-absorbing channelrhodopsin Chronos with eGFP and nls-mScarlet
-
Insert Size (bp)2475
- Promoter CamKII
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GATGCTGACGAAGGCTCGC
- 3′ sequencing primer CACACAGCGTAAAAGGAGCAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
peAAV-CKII(0.4)-Chronos_eGFP_GP2A_nls_mScarlet was a gift from Matthias Prigge (Addgene plasmid # 121542 ; http://n2t.net/addgene:121542 ; RRID:Addgene_121542)