Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pIS0
(Plasmid #12178)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 12178 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pIS0
  • Backbone manufacturer
    Bartel Lab
  • Backbone size (bp) 5264
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer n/a
  • 3′ sequencing primer EBV rev primer (GTGGTTTGTCCAAACTCATC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The firefly luciferase vector was modified from pGL3 Control Vector (Promega), such that a short sequence containing multiple cloning sites (5'-AGCTCTATACGCGTCTCAAGCTTACTGCTAGC GT-3') was inserted into the XbaI site immediately downstream from the stop codon.
3'UTR segments of target genes can be inserted into this vector to test for their effects on mRNA stability.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIS0 was a gift from David Bartel (Addgene plasmid # 12178 ; http://n2t.net/addgene:12178 ; RRID:Addgene_12178)
  • For your References section:

    MicroRNA-directed cleavage of HOXB8 mRNA. Yekta S, Shih IH, Bartel DP. Science. 2004 Apr 23. 304(5670):594-6. 10.1126/science.1097434 PubMed 15105502