Skip to main content

pX330-TP53-1
(Plasmid #121917)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121917 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330 (Addgene #42230)
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 8500
  • Total vector size (bp) 8487
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TP53
  • Alt name
    p53
  • gRNA/shRNA sequence
    ACCATTGTTCAATATCGTCC
  • Species
    H. sapiens (human)
  • Entrez Gene
    TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The sgRNA targeting TP53 was cloned into pX330 (Addgene #42230) using a Golden Gate Assembly reaction.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-TP53-1 was a gift from William Hahn (Addgene plasmid # 121917 ; http://n2t.net/addgene:121917 ; RRID:Addgene_121917)
  • For your References section:

    MDM2 and MDM4 are Therapeutic Vulnerabilities in Malignant Rhabdoid Tumors. Howard TP, Arnoff TE, Song MR, Giacomelli AO, Wang X, Hong AL, Dharia NV, Wang S, Vazquez F, Pham MT, Morgan AM, Wachter F, Bird GH, Kugener G, Oberlick EM, Rees MG, Tiv HL, Hwang JH, Walsh KH, Cook A, Krill-Burger JM, Tsherniak A, Gokhale PC, Park PJ, Stegmaier K, Walensky LD, Hahn WC, Roberts CWM. Cancer Res. 2019 Feb 12. pii: 0008-5472.CAN-18-3066. doi: 10.1158/0008-5472.CAN-18-3066. 10.1158/0008-5472.CAN-18-3066 PubMed 30755442