-
PurposeCRISPR-Sirius plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 121941 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1
- Backbone size w/o insert (bp) 8171
- Total vector size (bp) 8575
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsMay require 2 days to grow
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA-Sirius-4X(MS2-PP7)
-
SpeciesSynthetic
-
Insert Size (bp)404
- Promoter human U6 promoter
-
Tag
/ Fusion Protein
- no
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sbf I (not destroyed)
- 3′ cloning site EcoR I (not destroyed)
- 5′ sequencing primer cccttcaccgagggcctatttccc
- 3′ sequencing primer CTATTCTTTCCCCTGCACTGTACCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLH-sgRNA-Sirius-4X(MS2-PP7) was a gift from Thoru Pederson (Addgene plasmid # 121941 ; http://n2t.net/addgene:121941 ; RRID:Addgene_121941) -
For your References section:
CRISPR-Sirius: RNA scaffolds for signal amplification in genome imaging. Ma H, Tu LC, Naseri A, Chung YC, Grunwald D, Zhang S, Pederson T. Nat Methods. 2018 Nov;15(11):928-931. doi: 10.1038/s41592-018-0174-0. Epub 2018 Oct 30. 10.1038/s41592-018-0174-0 [pii] PubMed 30377374