pUC19-U6-AasgRNA3.8
(Plasmid
#121958)
-
PurposeMammalian expression, Genome editing, gRNA scaffold
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 121958 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC19, BsaI site mutated
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAaCas12b single chimeric gRNA, short version
-
Alt nameAaC2c1 single chimeric gRNA, short version
-
gRNA/shRNA sequenceGTCTAAAGGACAGAATTTTTCAACGGGTGTGCCAATGGCCACTTTCCAGGTGGCAAAGCCCGTTGAACTTCAAGCGAAGTGGCAC
-
SpeciesSynthetic
Cloning Information
- Cloning method Ligation Independent Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19-U6-AasgRNA3.8 was a gift from Wei Li (Addgene plasmid # 121958 ; http://n2t.net/addgene:121958 ; RRID:Addgene_121958) -
For your References section:
Repurposing CRISPR-Cas12b for mammalian genome engineering. Teng F, Cui T, Feng G, Guo L, Xu K, Gao Q, Li T, Li J, Zhou Q, Li W. Cell Discov. 2018 Nov 27;4:63. doi: 10.1038/s41421-018-0069-3. eCollection 2018. 10.1038/s41421-018-0069-3 PubMed 30510770