SEPT11 sh1 shRNA
(Plasmid
#122020)
-
PurposeKnock Down of Septin 11. It targetes Septin 11 mRNA. It knocks down all known splice variants of Sept 11 mRNAs.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122020 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonemU6pro
-
Vector typeRNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSEPT11 shRNA
-
gRNA/shRNA sequenceUCAAUGUGGAUUUGCCAAUAC
-
SpeciesR. norvegicus (rat)
-
Entrez GeneSept11
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer unknown
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byInsert was originally cloned in Angel de Blas's lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SEPT11 sh1 shRNA was a gift from Angel de Blas (Addgene plasmid # 122020 ; http://n2t.net/addgene:122020 ; RRID:Addgene_122020) -
For your References section:
Septin 11 is present in GABAergic synapses and plays a functional role in the cytoarchitecture of neurons and GABAergic synaptic connectivity. Li X, Serwanski DR, Miralles CP, Nagata K, De Blas AL. J Biol Chem. 2009 Jun 19;284(25):17253-65. doi: 10.1074/jbc.M109.008870. Epub 2009 Apr 20. 10.1074/jbc.M109.008870 PubMed 19380581